|
Addgene inc
non targeting sgrna lentiguidepuro control plasmid addgene Non Targeting Sgrna Lentiguidepuro Control Plasmid Addgene, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/sgrnas+targeting/non-targeting+control+gRNA+(BRDN0001487130)+(Plasmid+%2380262)/pm42864421-187-18-23 Average 92 stars, based on 1 article reviews
non targeting sgrna lentiguidepuro control plasmid addgene - by Bioz Stars,
2026-10
92/100 stars
|
Buy from Supplier |
|
Addgene inc
crispra sgrnas targeting capn2 Crispra Sgrnas Targeting Capn2, supplied by Addgene inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/sgrnas+targeting/lentiSAMv2+(Plasmid+%2375112)/pm42772564-181-0-14 Average 95 stars, based on 1 article reviews
crispra sgrnas targeting capn2 - by Bioz Stars,
2026-10
95/100 stars
|
Buy from Supplier |
|
Addgene inc
sgrna sequences targeting trmt6 Sgrna Sequences Targeting Trmt6, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/sgrnas+targeting/lentiCRISPR+v2+(Plasmid+%2352961)/10__1186_slash_s40170___026___00452___3-88-0-13 Average 96 stars, based on 1 article reviews
sgrna sequences targeting trmt6 - by Bioz Stars,
2026-10
96/100 stars
|
Buy from Supplier |
|
Addgene inc
sgrna targeting setd1b Sgrna Targeting Setd1b, supplied by Addgene inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/sgrnas+targeting/lentiSAMv2+(Plasmid+%2375112)/pm41933071-93-14-25 Average 95 stars, based on 1 article reviews
sgrna targeting setd1b - by Bioz Stars,
2026-10
95/100 stars
|
Buy from Supplier |
|
Obio Technology Corp Ltd
cndp2 targeting sgrna paav u6 shrna spgrna cndp2 v2 0 cmv egfp wpre Cndp2 Targeting Sgrna Paav U6 Shrna Spgrna Cndp2 V2 0 Cmv Egfp Wpre, supplied by Obio Technology Corp Ltd, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/sgrnas+targeting/0+cmv+cndp2+cndp2+egfp+paav+sgrna+shrna+spgrna+targeting+u6+v2+wpre/pm42276307-138-7-22 Average 86 stars, based on 1 article reviews
cndp2 targeting sgrna paav u6 shrna spgrna cndp2 v2 0 cmv egfp wpre - by Bioz Stars,
2026-10
86/100 stars
|
Buy from Supplier |
|
Genechem
plasmid transfection sgrnas targeting rnf214 Plasmid Transfection Sgrnas Targeting Rnf214, supplied by Genechem, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/sgrnas+targeting/candidate+piezo1+sgrnas+targeting/pm42265556-71-3-20 Average 86 stars, based on 1 article reviews
plasmid transfection sgrnas targeting rnf214 - by Bioz Stars,
2026-10
86/100 stars
|
Buy from Supplier |
|
Genechem
cd14 targeting sgrna Cd14 Targeting Sgrna, supplied by Genechem, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/sgrnas+targeting/cbx2+sequences+sgrna+targeting/pmc13253277-138-11-21 Average 86 stars, based on 1 article reviews
cd14 targeting sgrna - by Bioz Stars,
2026-10
86/100 stars
|
Buy from Supplier |
|
Synthego Inc
sgrna targeting mouse pcsk9 cccauaccuuggagcaacgg Sgrna Targeting Mouse Pcsk9 Cccauaccuuggagcaacgg, supplied by Synthego Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/sgrnas+targeting/cacuggaagagcaauggcug+gene+grna+mouse+targeting+trim32/pm42190011-200-1-13 Average 86 stars, based on 1 article reviews
sgrna targeting mouse pcsk9 cccauaccuuggagcaacgg - by Bioz Stars,
2026-10
86/100 stars
|
Buy from Supplier |
|
Synthego Inc
sgrnas targeting exon 2 Sgrnas Targeting Exon 2, supplied by Synthego Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/sgrnas+targeting/sgrnas/pmc13198606-31-2-21 Average 86 stars, based on 1 article reviews
sgrnas targeting exon 2 - by Bioz Stars,
2026-10
86/100 stars
|
Buy from Supplier |
|
Benchling Inc
optimal single guide rna sgrna target sequences Optimal Single Guide Rna Sgrna Target Sequences, supplied by Benchling Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/sgrnas+targeting/guide+rna/pm42167230-305-5-14 Average 86 stars, based on 1 article reviews
optimal single guide rna sgrna target sequences - by Bioz Stars,
2026-10
86/100 stars
|
Buy from Supplier |